Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13035D10
Clone ID IST13035D10
Vector VICTR76
Project tigm

Sequence tag IST13035D10BBF1
Sequence
ATATGATCTGGAGGACATGTGCTGATAAACTATCTATCTATTCTATGTGACTCAGCCTAGCAGGAGACAAAACAGATCTG
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110856165..110856244 80
NO GENE  


Sequence tag IST13035D10HMR1
Sequence
CAAGGTTACCCACGACCATTTTNATACAANNNNNAAATAGACTTTGAGTATGTTCCTTCTCTTTTGTGACCCCCACTAAG
TCTTTGGAGGTAGGGCCTGGTGGAGCCTGGGCTGGCCCATAAACTTGCTGTGTAGCCAGGGACCGCCTGATCCTCCTGCT
TCGTCCTCCCGAGTACTGGGATGCCTGGCTTTCACCACCAAGTCTGGCCGGCCTAGTGAGAGGTTTTGTACTTGCTCTCT
TAGGTGGGCACAGTGTGGTTCCTGTGCCTTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29691954..29692228 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es