Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14652B3
Clone ID IST14652B3
Vector VICTR74
Project tigm

Sequence tag IST14652B3BBF1
Sequence
CTCTCGCCCTCTTCCTGCCTAGTGCTGGGACNATCTAGCATTGCTCCTCTGTCCTTTTCTGTTTTGTTTGTTTGTCTGTT
TTTTGTTTTCTGATACATGGTCTCTCTGTTGTGTANCTTTGGTTGTCCTGGAATTTGCTATGTANACNNGGCTGTCCTTG
AACTCAAGAAATCTACCTACCCGCCTCTGTCTCCCAAGTCTCANGATACAGCCTGCTTTTGATTGTTTGGGACAAGGTCT
TACTATGTANACCAGGCTGGCCTCCAATTCATACAGATTTACCTGCCTATCTGGGATTAAAGGTATGTGTGTCACTATGC
CTTGCTAATTTTTACTTTCATTTGTTGAANTACNATCTCATGTNANCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148339646..148340013 346
NO GENE  


Sequence tag IST14652B3HMR1
Sequence
NAGGATGGAGATGCAGGTCCTTANCACCACAGGAAACAAGCCTCCGCTCCTGTCTGGGAGCCTCANCAATGTGTATGGCC
CCCTCTGAAGTGGCTGTGTGGGATTTTGAACAGGGCAGAGCCTTGTATCTGCTGGGCAAAGCAACAGGCACTGGCTCCTG
GGTTCTGGCTCTANCTCTGTGACCTGAATAAAGCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI23599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148340012..148340209 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es