Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0225
Clone ID DC0225
Vector pGT1lxr
Project sanger

Sequence tag DC0225
Sequence
AGCCACAGCNGACTTTGAAAAGGAATCTAAAGCATGCTGATGGTGAGAAGGAAGATCAGTTTAATGGAAGTCCTCCAAGA
CCCCAGCCACGGGGACCAAGAACTCCTCCTGGACCTCCTCCACCTGATGACGATGAGGACGACCCTATGTCTTTGCCAGT
GTCTGGTGACAAAGAAGAGGATGTTCCCCATCGAGAAGATTACTTTGAGCCCATTTCTCCTGATAGGAATTCTGTCCCGC
AGGAAGGTCAGTATTCCGATGAAGGAGAGGTAGAAGAGGAACCGCAAGAAGAGGGAGAAGATGATGAAGATGATGTGGAT
GTAGAGGAAGAAGAGGATGAAGATGAGGATGACTGCCATACAGTAGATAGTATCCCTGATGATGAGGAAGAAGATGAAGA
GGAAGAAGGTGAAGAGGATGAAGAAGGTGAAG
Sequence Type mRNA
Unitrap ID UNI3080

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11432722..11435326 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

 
Come back to gene ENSMUSG00000040720


For any suggestions or comments, please send an email to unitrap@crg.es