Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14733A5
Clone ID IST14733A5
Vector VICTR76
Project tigm

Sequence tag IST14733A5HMF1
Sequence
ATAACGCCAACCCTGCCTTTTGTTGTTCTTCTAGAGCAATCCGCACCCTTTGGTCTGGGCAAAACTGAAAGGATTTCCAT
TCTGGA
Sequence Type genomic DNA
Unitrap ID UNI3669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165658874..165658958 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14733A5HMR1
Sequence
TTATATTTGGCAGCAAGACACACATTCAAGTCTGAAAGGTAACCTGAACGCAGGGAGGCAGGGAGGGCACAGCCCTGTGC
TGATTAATTAGGCTTCCGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165658955..165659054 100
NO GENE  

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es