Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST461049
Clone ID OST461049
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST461049
Sequence
CTCACCCAACACATTTNCTGTGACTTTAACAACTACCAACTGCTACAGTGAGACATCTACATTGAGGCTGCTATCCTCAA
CACTCAAGAAGAACAACTCTGGAGAAAAGGAACCAGCAGACACCTTAGGGCTTGAAGTCACATGTCACATTTGTGTGCTA
TGGTTTTTATCTTCAGAGGGTATGTGGTGTGTGTGTGTGTGTGTGTGTG
Sequence Type mRNA
Unitrap ID UNI16449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18801412..18801618 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039842 (Mcph1) NM_173189 microcephaly, primary autosomal recessive 1 Gene [Source:MGI (curated);Acc:Mcph1-001]

 
Come back to gene ENSMUSG00000039842


For any suggestions or comments, please send an email to unitrap@crg.es