Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14184A6
Clone ID IST14184A6
Vector VICTR74
Project tigm

Sequence tag IST14184A6HMF1
Sequence
NCTAGAGCCNTGANTCCCACCATGTGTTTTCTTTGGTTGGTGGTTTANTCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14184A6HMR1
Sequence
ANCTNCATATGTAGGTGATGATGGCCTAGATGGTCATCAATGGGAGGAGAGGCCCTTGGTCCTGTGAAAGTTCTATGCCA
GAGTAAAGGGGAACACCTGGGCCAGGAAGCCAGAGAGGGTCAGTTGGTTAGCAGGGGGAGAGGCAATAGGATAGGGGATT
TTTGGAGAGGAAACTANGAAAGTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI15628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 146352749..146352933 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067919 (Rex2) NP_033077 reduced expression 2 Gene [Source:MGI (curated);Acc:Rex2-001]


Sequence tag IST14184A6BBF2
Sequence
GCTAGAGCCATGAGTCCCACCATGTGTTTTCTTTGGTTGGTGGT
Sequence Type genomic DNA
Unitrap ID UNI33967 UNI35809 UNI35810

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 16478..16521 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166468: 35122..35165 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11660432..11660475 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27924727..27924770 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56666486..56666529 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17320384..17320427 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5853148..5853191 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18115957..18116000 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37328997..37329040 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27380668..27380711 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 24398890..24398933 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14711758..14711801 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40485996..40486039 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045555 (9030224M15Rik) NM_177793 RIKEN cDNA 9030224M15 gene Gene [Source:MGI Symbol;Acc:MGI:3045338]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7530668..7530711 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 13276729..13276772 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16422002..16422045 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041583 (Obox6) NP_663756 oocyte specific homeobox 6 Gene [Source:MGI Symbol;Acc:MGI:2149036]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 19308154..19308197 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4413492..4413535 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9956252..9956295 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 69685189..69685232 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031343 (Gabra3) NM_008067 gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 3 Gene [Source:MGI (curated);Acc:Gabra3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 15292585..15292628 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 25707348..25707391 44
NO GENE  

 
Come back to gene ENSMUSG00000031343


For any suggestions or comments, please send an email to unitrap@crg.es