Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST460887
Clone ID OST460887
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST460887
Sequence
GACTGAGGAGACGTCAGAGCACTGACCAAAGGTGTCCAGGCTGTCATGGGTTACAAGCCCGGGCATGGCCTGGTGACTGC
GGCTGCTGCGAGCGCTGAGAATGTACCTGGGAAGCCCTGGAAAAAACACGGTAACAGAAACAAAAAAGAGAAAA
Sequence Type mRNA
Unitrap ID UNI16437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30561801..30561950 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022538 (Lsg1) NM_178069 large subunit GTPase 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsg1-001]

 
Come back to gene ENSMUSG00000022538


For any suggestions or comments, please send an email to unitrap@crg.es