Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10040F2
Clone ID IST10040F2
Vector VICTR75
Project tigm

Sequence tag IST10040F2HMR1
Sequence
ATCTTAATGTGGTATTTAGGCTCCCAGATGTAGGTAGGATAAGACTCAGCATATTGACTCAGGATGCATTGACCTGGAGA
T
Sequence Type genomic DNA
Unitrap ID UNI6494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34691932..34692012 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029110 (Rnf4) NP_035408 ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]

 
Come back to gene ENSMUSG00000029110


For any suggestions or comments, please send an email to unitrap@crg.es