Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14424C9
Clone ID IST14424C9
Vector VICTR74
Project tigm

Sequence tag IST14424C9HMR1
Sequence
TTGTGAACGTGACTGTAGTTTGAAAGCGAAGTGTTTGCCCTGTGGGCTCGACTTCACGGTTTGAAAGGCTGGAGAAAGTG
AGACGTGTAAGGTTTTCCGGTCTCACCCGCCTGGGATGCCTAGAACCAGCGTCTCATGATGAATAAATATCCTTGGAAGG
GTCTGCTTGCCN
Sequence Type genomic DNA
Unitrap ID UNI24008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116812815..116812985 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055531 (Cpsf6) NM_001013391 cleavage and polyadenylation specific factor 6 Gene [Source:MGI Symbol;Acc:MGI:1913948]

 
Come back to gene ENSMUSG00000055531


For any suggestions or comments, please send an email to unitrap@crg.es