Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST460719
Clone ID OST460719
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST460719
Sequence
GACTGAGAGCTGGCCGTTACCGATTTGCTCCTGGACCACACCTGTCCTGACCCGGGAAGTGAGACCCCTGACCCTGGAAC
TTCTTGAGGAAACTGTGCAGGCCATGGAGGTGGAATGAAGTGGCCTGAGATGTAGAGTTTGGAATGAGGGTGAATAAATC
CGGGAAACACAAACACTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108459626..108459807 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031897 (Psmb10) NM_013640 proteasome (prosome, macropain) subunit, beta type 10 Gene [Source:MGI Symbol;Acc:MGI:1096380]

 
Come back to gene ENSMUSG00000031897


For any suggestions or comments, please send an email to unitrap@crg.es