Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST460625
Clone ID OST460625
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST460625
Sequence
GGCAGACCCTTGGCAGGAGTGCATGGCACTATGCAGTAATCCTCGCGAGGCAAGCTGGAGAGATGATTCGTGAAGCTTTA
AAAAATGAGATGGATGTCATGATTAAAAGTTCTCCAGCCGACTTGGTAACAGTTACTGACCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 10328395..10329003 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027531 (Impa1) NM_018864 inositol (myo)-1(or 4)-monophosphatase 1 Gene [Source:MGI (curated);Acc:Impa1-002]

 
Come back to gene ENSMUSG00000027531


For any suggestions or comments, please send an email to unitrap@crg.es