Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15098B12
Clone ID IST15098B12
Vector VICTR80
Project tigm

Sequence tag IST15098B12HMR1
Sequence
NCNNANGCTCATANTTTCCNANNCTTCTCNNNGTNNTTTCACCTANCACATCATAGAACCAATTTGGTTAGGCCCAAGGC
GGTGGTGCTTGCCTTTAATCCTCCACTAAACAAGCAAAGGCAGGCGAATCTTTGTGAGTTCTAGGCTAGCCTAGGCTACC
TGAGAATTTCAGGCTAGCCAGGGCCATTTAGTGAGACCCCATCACAAAAACCAACTAATCTACTAACCAACCACCCACTC
AAACAAACTAGAAACCTGGGAACACATTCTAGGCTGGAGCTAGAAGAGGTGACTTAGTCCCTAAACCCCAGCACTTGAAA
GGCTAAGATTGTAGGACTACAGAGCTACAGTGTTGGAGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155044902..155045255 333
NO GENE  


Sequence tag IST15098B12BBF1
Sequence
AGGGCTAAGTCTATAAAGTGAGTTTGAAGGCAGGGCTATGTAGAGAGAAGCTGTCTCAAAGAACCAAAACAAAAGGTTTC
GACCAAGTAAGACAGTCCAACGTGGGATACAATTAAGCAGACCAGTTGGGGCACCTCTAATTCCAGCTCTTGGGAGGATG
AGGCAAGAGTATCTGGATTTTGCTAAAGGCCAGTGTGGTCCTATGTAGGAAGGAAAAAAGACAAGAAACACAGCCAGACA
TTTTTTTAATGATGTAGGCGTGTTACTACNAATGCATCCTTACTTTCAGGATTTCTATCAGTGAATTTACACAACTCACC
TATGAGAATTCTAGGCCNTATAACCNTATGGGANTTACNTAGTGTGGGTATTTGGAAATGGTTATATATGGNGCATGACT
GNANNTNCNNCN
Sequence Type genomic DNA
Unitrap ID UNI24143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87438538..87438938 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST15098B12HMF2
Sequence
AGGGCTAAGTCTATAAAGTGAGTTTGAAGGCAGGGCTATGTAGAGAGAAGCTGTCTCAAAGAACCAAAACAAAAGGTTTC
GACCAAGTAAGACAGTCCAACGTGGGATACAATTAAGCAGACCAGTTGGGGCACCTCTAATTCCAGCTCTTGGGAGGATG
AGGCAAGAGTATCTGGATTTTGCTAAAGGCCAGTGTGGTCCTATGTAGGAAGGAAAAAAGACAAGAAACACAGCCAGACA
TTTTTTTAATGATGTAGGCGTGTTACTACAAATGCATCCTTACTTTCAGGATTTCTATCAGTGAATTTACACAACTCACC
TATGAGAATTCTAGGCCATATAACCATATGGGAGTTACGTAGTGTGGGTATTTGGAAATGGTTATATATGGGGCATGACT
GTAATTTCTTCTCTCATAGAGTGGAAGANTTAAGGGGGAGGGTGTGTGTGTGANTGTGTGTNACTGNNCCCNGATCNTCN
TACCN
Sequence Type genomic DNA
Unitrap ID UNI24143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87438455..87438938 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es