Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14578B1
Clone ID IST14578B1
Vector VICTR74
Project tigm

Sequence tag IST14578B1BBF1
Sequence
CCTAAACAACCCAGGATGATAGACGGTTGCTCTCTGAAAACCAACAGTGAGGCCCAATTGCTGAGGACATCTACACAGCT
CATTGAACCTGGAGAGGTCCAGCTGGTGCCTGTATGGAGTTTTCGCCCCTATGTTCTAGTCTCTTTGGTATAGGAAGGTA
CTTTGCAGGCTACCAAAAGAGAAAGCTGGAACCTATCCTGCCCTGCAAGATGCGCAGAATTTGTGGGAGTGGCCAAACAA
TGTTTGGTTTAACTTGAGACTCATGCCACAAGATAGAGGCCATGACCTAAACTGCCTGAATGGCCAAGAACCAGAGACTG
GAGAGCTCTGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16143341..16143676 336
 
EST/CDNA Est Name
  CA535092.1 - BQ556338.1 - BG062790.2 - BB857709.1 - BB864490.1 - CJ172793.1 - BY317453.1 - BY025841.1 - BY015846.1 - BB841948.1 - BY288452.1 - BY334383.1 - BY196277.1 - BY021004.1 - BY024546.1 - BY068869.1 - BY065962.1 - BY063147.1 - BY073654.1 - BY106904


Sequence tag IST14578B1HMR1
Sequence
ANGAAACTCCAAGGGAACCCCTTGANNNNNACTCAACTGAATGCAACCCAGTTCCACCAGTGGAAGCCTTGTCTAGCTAC
AAAAAATGGCTAGTTCAGACTCTATTTTCCATTCCTAGGAGTCTTCATTAGGTTCACCCTCANAGATTTCAGGAAGTTTA
CACTATACAAGGTTTTTGTACCACTTTCCTAGTATTCTGTACTTTTTTGGCTAATATTCACTTATTAGTGAGTACATACC
GTTCATGTCCTTTTGTGTCTGAGTCACCTCATTTAGGATATTTTCTAGTTCCATTTGCCTGCNAAACTCATGATGCCCTT
GTTTTTAATAGCTGAGTAGTATTCCATCATGTAAGTGAACCATATTTTCTGTATCCATTCTACAGTTATGGGACATCTGG
GTTGTTTCCNGCTTCTGGCTATCACAAATAAGACTGCTATGAACNTATTGAAACATGTGCCCCTGTGGCATTGTGGGGCA
TATTCTGGGTATATGCCCNAGAGTGGTATAATTGNGTCTTTANGTANANANANTTNCNATTTTNAGANGNACCTN
Sequence Type genomic DNA
Unitrap ID UNI21888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16142789..16143341 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]


Sequence tag IST14578B1HMF1
Sequence
CCTAAACAACCCAGGATGATAGACGGTTGCTCTCTGAAAACCAACAGTGAGGCCCAATTGCTGAGGACATCTACACAGCT
CATTGAACCTGGAGAGGTCCAGCTGGTGCCTGTATGGAGTTTTCGCCCCTATGTTCTAGTCTCTTTGGTATAGGAAGGTA
CTTTGCAGGCTACCAAAAGAGAAAGCTGGAACCTATCCTGCCCTGCAAGATGCGCAGAATTTGTGGGAGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16143341..16143575 235
 
EST/CDNA Est Name
  BY121206.1 - CA534894.1 - BY329109.1 - BY023832.1 - BY073576.1 - BY780609.1 - BY332524.1 - BY330337.1 - BY022182.1 - BP757851.1 - BG062344.2

 
Come back to gene BY121206.1 - CA534894.1 - BY329109.1 - BY023832.1 - BY073576.1 - BY780609.1 - BY332524.1 - BY330337.1 - BY022182.1 - BP757851.1 - BG062344.2


For any suggestions or comments, please send an email to unitrap@crg.es