Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14962F3
Clone ID IST14962F3
Vector VICTR76
Project tigm

Sequence tag IST14962F3BBF1
Sequence
CAGACAGACTCCACGTGTTCACACGCAGGCTCTGCCCATGTTAAATCTGTCTTGAAAGCTAGCTTATTTTCTACCGTGCC
TCTAACTTGGCACAGCTCTGANAAACATCCCATGGCACAGCCATCTGGGTTGAATAAAAGAGGGAGGGTTTTTTTGTTGT
TGGTTTTTTGGTTTNTNTTN
Sequence Type genomic DNA
Unitrap ID UNI15985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66510730..66510908 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST14962F3HMR1
Sequence
GTCTGCTCTGTCCTCGTCCCTTGACACGGGCTCCTGGGATTGAACTTAGGTCACCTGCAAGGGCATTTATTTACCTGCAG
AGCCATCTTTCCAGCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66510904..66511000 97
NO GENE  

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es