Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10478G5
Clone ID IST10478G5
Vector VICTR76
Project tigm

Sequence tag IST10478G5BBF1
Sequence
ATAACACATTGCAGGCAGAGGGGGAGGAGCCTGGTCTATACAGTTCTCTGCTCAATGAATGCCCTCTCCCCGATCTGAAT
CATTTCTAAACTGTGCAGCTAATATTGCTGCTTTAAAAAAAAAAAAAAANCNNAAANNTNAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10478G5HMF1
Sequence
ATAACACATTGCANGCAGAGGGGGAGGAGCCTGGTCTATACAGTTCTCTGCTCAATGAATGCCCTCTN
Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94000995..94001061 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]


Sequence tag IST10478G5HMR1
Sequence
TATANAAGCAGCTGTCACATGTGTTTAGGAGGAGGGTGCTATGGTTAGCATGTATTAACATACAACCCACGTACCACCCG
TATGTCTTACAACACTGAGCCCGTGTGACAGCACTAAGGTCCCTGTCGGTCGTTTCAGTTCTGTTCTTTTTGCCCAAAAC
ATGGTCAAAGGTGTTTATGGGGCATGTANGCTTCCTTCTGACTCTCATCCAGGGTGACACCCCAGGATGCAGGATCNNAC
CTGGTTGGAAGGCTTCCNGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94001059..94001315 249
NO GENE  

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es