Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13793E3
Clone ID IST13793E3
Vector VICTR74
Project tigm

Sequence tag IST13793E3BBF1
Sequence
ATCCCACACGGGGGAGGGGCAGTGGTAGAGATTTCCTACGGAGAGAACCTGCAGGTAGCACGGGGCTGTCACTGGGAGGA
AAGATTCTATGTCACACACCCCCCTCCCTGTCGCCTAAAAAAAAAAAAAAANCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51502525..51502655 131
NO GENE  


Sequence tag IST13793E3HMF2
Sequence
TAATTATTTCCAGATGTGTGTGGGCTTCAGCGTGAGAACTCCTCCAAAAAGCATGGATGGGGGTGACTTACCTTCAGTAA
TTCCAGCACTAAGTGGGTGGAGGCAGGAGGATCANAGGTTTAANACTAGCCTTGAGTACATAAGGTACAAAGCCAGTGTG
GGTTACATGACATCTTGTCTCAAAAAGGGAAAGAAAGTTGGCAAGGTAAGCTACTGTATTTAAAAGCCCTTTAATGTAGT
TTAATTGCATGTGTTTTTAAATTTGTGTTAAAAGTTCACTGGAACTGGAANAAATGGATTTATCTGCCGTCCAAATTCAA
GAAGTACAAAATGTCCTTCATGCTATGCAGAAAATCTTANAGTGTCCNANCTGGTAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101410322..101410701 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es