Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13601G10
Clone ID IST13601G10
Vector VICTR74
Project tigm

Sequence tag IST13601G10BBF2
Sequence
GCTGTAAATTAGTAAGCAAATGCAGATTCCTCATTGAATTCATTACACCCATCTGTTAGAAGGGAACACCCTCTTTTGTT
TTTCCTCTTGGCATTCAAGTCTGGAGCATTCTGTGCAACCTGAAATACAAGCAGCAAGGCAAAGGCGGGTGTANTGGAAN
ATCNGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 130107490..130107656 157
NO GENE  


Sequence tag IST13601G10HMR1
Sequence
CAGCAACTAAGAACTTGCTTCTGATGTATGATGCAAATAAAAACTGTCTTCCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI6919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 130107653..130107708 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es