Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST460261
Clone ID OST460261
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST460261
Sequence
CACATTTAACGCCTCTGTGCATTCAGCACACACCATCCGTCACCCGGGGAGATCTCATCAAATTGTTCTGTATCGTCACT
GTGGAAGGAGCTGTGCTGGACCCAGATGACATGGCCTTCGATGTATCCTGGTTTGCGGTACACTCTTTTGGCTTGGACAA
GGCTCCCGTCCTCCTCTCCTCCTTGGACCGGAAGGGAGTCGTGACGACAGGCCAGAGGGACTGGAAGAGTACTGTCAGCC
TGGAGCGAGTGAGCGTGCTGGAATTCTTGCTGCAAGTGCATGGCTCTGAGGACCAGGACTTTGGCAACTACTACTGTTCT
GTGACTCCCTGGGTGAGGTCACCGACAGGTTCCTGGCAGAGGGAAGCCGAGATCCACTCCAGGCCCATCTTTATAACTGT
GAAGATGGACGTGCTGAACGCCTTCAAGTACCCGCTGCTGATCGGCGTGGGCCTGTCCACAGTCATCGGGCTCCTGTCCT
GCCTCATCGGATACTGCAGTTCCCATTGGTGCTG
Sequence Type mRNA
Unitrap ID UNI16471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 100847343..100854116 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027864 (Ptgfrn) NM_011197 prostaglandin F2 receptor negative regulator Gene [Source:MGI (curated);Acc:Ptgfrn-001]

 
Come back to gene ENSMUSG00000027864


For any suggestions or comments, please send an email to unitrap@crg.es