Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14868H2
Clone ID IST14868H2
Vector VICTR76
Project tigm

Sequence tag IST14868H2HMR1
Sequence
ACGGTGCTTGATATAAAAAATATGCATCATGGGTAAAGACAGGGCATCAAGATAGTGACTGTTACAGCAAGGTGCAAGCT
GACGGTGTGTGGGACAGATGCTGGTGGGAAAAGCTGGTTGGAAACTGTGGGTGGNAGGAGGANTGNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29360053..29360197 141
NO GENE  


Sequence tag IST14868H2HMF1
Sequence
GTACCCTCATTCCTCTAAGAATAAAACTGCCGTTCAGACTTACCGACCTCTCTTGGCTGCAATCAGGGAGTAGGGCCGTG
ACTCAGCATGTTAACAGGCAAGGTGTGGGAACACCTGGA
Sequence Type genomic DNA
Unitrap ID UNI35821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29360196..29360313 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]

 
Come back to gene ENSMUSG00000026799


For any suggestions or comments, please send an email to unitrap@crg.es