Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15079F6
Clone ID IST15079F6
Vector VICTR80
Project tigm

Sequence tag IST15079F6HMR1
Sequence
TTGAATGTAGACTTTTAATGTCTTGAAAGACAGATGCTGTAAAGATACCAAACTCTGTATATAAAGCAGAGAAGAAATCT
GAGGGGGANAANANNGGGCCNNATCNNNNGACGTGGAGGGCAATTCTATAATCATTCTTCTAATAATAATGTTAATATTT
CTCTATCATTTTGTTGAAAATCCCATCGCACCTCCACAGCTATACTGTGCATTGGTTTTCCTATAGGACACACAAGCAGC
TTGTCACAGGAGGTGTGTGAGTCATGCTTTATTAGATGTTAGCCAGTTGTGCTGAAAAAGAAGAGTTACTCCACATTTGT
GTGCACCGACTTGCCTCCCATTAGCTTTATCAGGTAAACAGAAATAAGACTGGTTTGTGTTTCTNANCCTTAGCAGGACT
TTCACCACTTTTTCTATGTTTATATTCATTTTTATGGAATTTTN
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129651933..129652374 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]


Sequence tag IST15079F6BBF1
Sequence
CATAAAGCTACACTGCTATAATAATTCACCTTGTTTTTACTTATTGCTGTTAATCTCATCCTGTGACTAAACTATAAATT
AACTCTTTTTGTAGGTAGGTCGATGGTAAAGCCATCCTTCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129651809..129651934 126
NO GENE  

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es