Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST460025
Clone ID OST460025
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST460025
Sequence
ACTGAGAGCCAGTCAGAACAACTCAGCAACCCTTGAATTTGACTCTCCAACTTTAGGAACCTCGAAAAGTGAGACGATTC
TGGGATAAGAAACCTTCCCTGTTTGAGGACATTGGCTTCATTTTATACTGTTTTGGCATGGACTGTATTTATTTTCAAAA
TGGCTTGTTTTTGTTTTTCTTGGCAAGTTTTATTGTGAGTTTTTCTAATTATGAAGCAAATTTTTTTTTCCACCATGCTT
TATGTGATTGTATTTAAATTGATGTGTTATTATGTCAAAAGCCGGATCTATTAAAGAAACAATTGGCCTTTCTGAGCTGA
TTTTTCCATCTTTTGTAATTATCTTTATTAAAAAATTGTACTTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16484

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36721333..36721695 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019777 (Hdac2) NM_008229 histone deacetylase 2 Gene [Source:MGI (curated);Acc:Hdac2-001]

 
Come back to gene ENSMUSG00000019777


For any suggestions or comments, please send an email to unitrap@crg.es