Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0164
Clone ID DC0164
Vector pGT1lxr
Project sanger

Sequence tag DC0164
Sequence
CAGCTTACCCTGAAAGTGGTGTCAGCAAAGCNCAAGGTGCACAACCGCCAGCCCAGAATCAACTCCTACGTGGAGGTGGC
AGTGGATGGACTCCCCAGCGAGACCAAGAAGACGGGGAAGCGCATCGGGAGCTCTGAACTGCTCTGGAATGAAATCATCG
TTCTGAATGTCACAGCCCAGAGTCATTTGGATCTGAAGGTCTGGAGCTGTCATACCTTGAGGAATGAACTACTGGGCACT
GCCTCTGTCAACCTCTCCAATGTCCTGAAGAACAATGGCGGCAAAATGGAGAACACACAACTGACCCTGAACCTGCAGAC
AGTGAACAAAGGCAGTGTTGTCTCGGGAGGAGAGCTGACAATTTTCCTGGATGGGCCAACTGTTGATCTGGGAAGTGTGC
CTAATGGCAGTGCAGTGACAGACG
Sequence Type mRNA
Unitrap ID UNI3091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109976948..110007369 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es