Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710D10
Clone ID IST14710D10
Vector VICTR76
Project tigm

Sequence tag IST14710D10HMF1
Sequence
CCTTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTTGAACA
Sequence Type genomic DNA
Unitrap ID UNI31996 UNI31997

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 48388269..48388315 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063434 (Sorcs3) NM_025696 sortilin-related VPS10 domain containing receptor 3 Gene [Source:MGI Symbol;Acc:MGI:1913923]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6148222..6148268 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 103532024..103532070 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033004 (Mycbp2) NP_997098 MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140501484..140501530 47
NO GENE  

 
Come back to gene ENSMUSG00000033004


For any suggestions or comments, please send an email to unitrap@crg.es