Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12232E1
Clone ID IST12232E1
Vector VICTR76
Project tigm

Sequence tag IST12232E1BBF1
Sequence
ACACAAAGTTAAATGAGTTCTGGCCTCTATTAGAGGAAAGAAGGTGTCAAATGAGAGATTGGAGAGTAATGGAGAAGAAT
TAACCAAGGAAGAAGGTGACTTTGTGGAACCTGAAGTTAGACTTCCTTGGGACACACTAATCCACACTCTTGAATGCTTT
TCTCTAGCCCATTTAATTGCTACAGTGTGACAAAACAAGTGGAGCTTTACTGTATAAACAAAACAAGCAGAGCACCCTGG
GGATGGCGGGTGCTGCATCTCACCGCCTCTCTATCCTCCTCTCCCCAGCCCTCACCAGACNANGGNATNNANNNNNNNNN
NNNNNNCGACAGGTTCCACCAGCACTTCCGTGACCNAGCAATCGTGAGCGCAGTGGCAAACCGAATGGACCAGGTAATAT
CCAAGTGGGTCAGCCAGTGATCAGCAAGGAACAAGGTCTGTCNTTGAGATGGATGTCAGATGTANCCACTGGCTCNGGGC
CN
Sequence Type genomic DNA
Unitrap ID UNI35829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96523296..96523776 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028099 (Polr3c) NP_083201 polymerase (RNA) III (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:1921664]

 
Come back to gene ENSMUSG00000028099


For any suggestions or comments, please send an email to unitrap@crg.es