Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15050A4
Clone ID IST15050A4
Vector VICTR80
Project tigm

Sequence tag IST15050A4HMF2
Sequence
GGTTCAAGAATAGGGGTTTCTTGGTGGGTATGANAACTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67056609..67056652 42
NO GENE  


Sequence tag IST15050A4BBF1
Sequence
GGTTCAAGAATAGGGGTTTCTTGGTGGGTATGAGAACTGTCAACAGGCTCAGGGCAGACAGCAGAAGCAGCAGACAGCAA
GGGTCCCAGCCTCTCCTGGACTTGGGGGCACAGGTTTTCCTGCTTCCTGCTATGTAAGTAAGCCTGAGTAAGCTCCAGAT
GTCTGTCACCTACAAAGCCAAGCATCTGAGGAATGTCTGGAATTTGGGGCATGTGGGGCGTGTGATGTGTGTTTTCTGTT
CTTCACTGGGATGGAAATCCCTAGCTATTTTGTCTGGAGGCATCANCCTTGACCTGAGGACCCCTAANCTGAANGTATGG
GAGANANAANAAATGCTAGGCTTCTGCCCCTANGGCGGGGTGCTTCCATNNNNGTTTGAACTNNAAGANTTGTTCGTTGN
NNTGANGGTGNNGCATCTTGGGACNNANNGNANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15050A4HMR1
Sequence
AAACNANNNNTNCNNTCTNANNNCCNNNNGNNNANNNTNNCGCNTAAGGTGAATTGTACAGGACCCCCAACCCTGCTCAC
TTTCTTTGTGCAGTATTCATTAGTTTATTTTTATAAAAAGATGATTAAATAAAACTGATAATTGACTGAGTCATTTTAGC
TTAAATATACGACCGTAATAATTTTCCACAGAAGGAAATGCTCTCTGTGATATGCCTTTTCACTAGAAAATTTTGCATAT
TAATATGGTTTTTTTTCCTAGTCTGATTANATTATGGATAACTTTCAGCAAGTGTTTTGAGTATTCAACTTTTATGTCNN
ANAAAGAAATTTCTGAAAAACATGAAAATGGCCN
Sequence Type genomic DNA
Unitrap ID UNI25742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76328793..76329101 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es