Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11850G6
Clone ID IST11850G6
Vector VICTR76
Project tigm

Sequence tag IST11850G6HMF1
Sequence
AAAGTTAGCGAGGACTAATTATAAAGTAGCCCTCTGACCTCCACATACTTGTCCTAGCATGTACGTACGTACACACACAC
ACACACACACACACACACACACACACACACACACACACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84772262..84772380 119
NO GENE  


Sequence tag IST11850G6BBF1
Sequence
ATGCACACACACGAATGCGTTGACCGAGCATGTTGACCACTTCTGTGTTTTGCTGTGCAGACATGCCTCAGCTTCATTTT
TATGTGAATTCTGTTGTANAAATGAGGTTAAGAATCTTAACTAAATCCCCTGTANCTGGGTGAGCTGGTGTCTGCACCAT
Sequence Type genomic DNA
Unitrap ID UNI35830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64753298..64753457 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035492 (Dennd4a) DENN/MADD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2142979]

 
Come back to gene ENSMUSG00000035492


For any suggestions or comments, please send an email to unitrap@crg.es