Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11408F8
Clone ID IST11408F8
Vector VICTR76
Project tigm

Sequence tag IST11408F8HMF1
Sequence
ACAGCAAGATTCCATCTCCAAAATGATGAGACCAAAATGAAAGACAGGANAAGGAANAAAAATAAAAAAGAAGGGGCAGA
AAGAGGAAGAAAGGGTAGGAAATGGAAAGGGGGGTCAGAAAGTTGGGAAAGGGTGCTAGGGAGATAGCTTAGTCAGTACA
GTGCTTGCTGCACACACATGAGGACCTGAGTTCAAAGGCCCAACACTCAAGTAAAAATAGAAAACCATGGCATACCTCTG
TNACCTGANCNNTGGGAAGTCAGAGATAGAAAGATCCATAAAGGCTTACTGTCCAGCCNATCTAGCCNATCNNTGAAATT
NANTCAGTCCGAAAACAAAGTAGAGAGCCATCAAAGACCTCTGACCTCCACACAAGCATACACACACAGACACAGACACA
GACACACACNCNCNCACNCNCNCNNNNNNNTGTATANNTGNNCCNCCNNACACANANACCCATACACANAANANTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11408F8HMR1
Sequence
AAGCCCTTGGCCTTATACTCCTGAGCGCAAGGATCTTCTTGTCTTGGCTTCTCAAGCCTTTGCATATCTGTCCTGCAACA
TTCAGAATAGGACTGGGAAAAGTCTTTGGTTGTTGTCTGATATGATACCGCCCTACCTCTCTTTCAGCCCTGAAATATCT
TAATAATTTTAAGCATGTGGTTAAGTAGAACATATTTTAAATCATAACAATAGACCTTTTANAATGAGCTGAATTGACAT
TTGATTCTTTGAAACATTTTGAGGTTTTTAATTAAAAAAATCTAGAGTGGTATANAACCTGTTAAACTCNCTCTGATNCN
ATGTTCAGAANCAGTGTGACTTACTGCTTGAAAGGACNGANGTCN
Sequence Type genomic DNA
Unitrap ID UNI16525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66216488..66216851 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es