Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11806D12
Clone ID IST11806D12
Vector VICTR76
Project tigm

Sequence tag IST11806D12BBF1
Sequence
ACTATATAGATCAGGCTGACCTCTAAGTCACANAGATGCCTTTTTCAGCTTCCTGGCTGGGCCACCTCCTGGCACATGAC
TTTAACATAGCATTGGGGAGGAGGCGACCCCTGTGGTATAANNNNTTTTAAAGACAGGTCTATGTACTTGTGGCTGGCCC
GACACTCACTATGTAAATTANGCCTACCTGGAACTCAAGAGAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154165009..154165217 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es