Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11436F1
Clone ID IST11436F1
Vector VICTR76
Project tigm

Sequence tag IST11436F1BBF1
Sequence
ACGGAACGCCGTCGTTTCTCGGCTCANGCCCCGCTACGGCCCCGCCTGGGCCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648302..91648360 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es