Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14717B7
Clone ID IST14717B7
Vector VICTR76
Project tigm

Sequence tag IST14717B7HMR1
Sequence
CTGTGTGTGATATACCTGCNNNCATGTTCAGGACCATATTAATCACANGTATCTGAAATCTAAATCAAGGTCCTCTCAAT
TTTAGAAGAGTCAAATTACTAAATGAAAAACTGCTAGAGAAATCCAGTGTGAACTTGCTAGGCTGATATGGTTGCCTGGT
GGGCGACTGTTAAAGCTGTAGAATACAATCACGGTAAAGGCGGCTGANTTTCTTAGGACTTTTTATTTAAAAAACAATGA
AGTGGACAAACATAAATTTAAGCACTAACCCCTATTANAACAGCCATAATTAGGGGTTATAAAAACAAAACANCAACAAA
AAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98626048..98626373 312
 
EST/CDNA Est Name
  CR518955.1


Sequence tag IST14717B7HMF1
Sequence
ACAGTAGCTATAGTCTCTTTCATTGTGGTTAATCTTAGGACGTGATAGGAGACAGAAATCCTAACTGCTGATCTCTGTAG
TTAGGGTTTGGTAAGTTTATTTCTGCAAAATTATATTATTGCATTTAACATAGGAACATTTCTTTCATGCTTGGTACTTG
CTGTGTNNACAGTGGTAATTTANATTCTTTGGGCAGTGCTAACCTTCCTTGGTAAATGN
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98626370..98626587 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]


Sequence tag IST14717B7BBF1
Sequence
ACAGTAGCTATAGTCTCTTTCATTGTGGTTAATCTTAGGACGTGATAGGAGACAGAAATCCTAACTGCTGATCTCTGTAG
TTAGGGTTTGGTAAGTTTATTTCTGCAAAATTATATTATTGCATTTAACATAGGAACATTTCTTTCATGCTTGGTACTTG
CTGTGTATACAGTGGTAATTTAGATTCTTTGGGCAGTGCTAACCTTCCTTGGTAAATGGAAACTTATGGANAANACTACN
TGGAANGNAAAGATTTTGANATCTGTCNCCATGGGGATTTTTANTCNNANACNNNTN
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98626370..98626655 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es