Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10023D10
Clone ID IST10023D10
Vector VICTR75
Project tigm

Sequence tag IST10023D10HMF2
Sequence
ATAGAAGTCCCTAGGCACGCAAAGTAATTATCCTGTATTTTTCTAAGCTTTTGTTGTTGTTGTTGTTGTTTGGTTTTGGT
TTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGACCTGGAACTCAGAA
ATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTATGCACCACCACTGCCTGGCTTTTCTAAGCTTTTAAAGCA
TACTCTAACACAAATTTGAAGACTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 47078079..47078345 267
NO GENE  


Sequence tag IST10023D10BBF1
Sequence
CTCCATGGCCTTTCCTGGCTCTAAAAGATTATGATCCTAGAAACTAAGATTTGCCAGGAAATAGTTTGCCTAAATTATAA
CAATTCTCATACCAGTTAGCTTTTGGCTTTGAAAACCGAGCCGCTTTTCTGGTATACAGCTGCTGGCACTGTGACCAAGG
AGCAGGGGTACTAGAAGGGAAAAGAGACTGGGTAGTGGTGCTTCCACCTACTGGCAAGGAGCTGAATGACTCCAGATAAT
TTGCAACCCTGACTCATGGTAAAGGCTTGTAACCCAGCCACTCTGGAGGCTGAGGCAGGAGCATCCCAAGTTCAAAGCCA
AGTACAGAGTGAATTCAAGGCCTCTCGGAGAAACTTACTGAGACCCAGTCAATATTAACAGAGGGATTGGGGCAGGGCTC
ATGGTAGAGCATTTGTTATCATGCTCAAGGCTTTAAAGAGCAGTGGTTCTCAACCTTCCTAATGCTACAACCCTTTAATA
CAGTTCCTCATGTTGTGGTGACCCCTAACTGTAGTTATTTTGGTTGCTACTTCATAACTAGTTTTGCT
Sequence Type genomic DNA
Unitrap ID UNI16969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54995456..54996003 548
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es