Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10755E3
Clone ID IST10755E3
Vector VICTR76
Project tigm

Sequence tag IST10755E3HMR1
Sequence
TNNAGAGATGCTGTTCTGGCCNGCAAGAAAAGGACTTTGCTAAGCAGAGTTTTCAATACCCCAAATGTNGAGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10755E3HMF1
Sequence
AGGCAGGCAGGAGATCTGTAAATACAAAAGCTCCAGGTGGA

Sequence Type genomic DNA
Unitrap ID UNI21463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11731722..11731761 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es