Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14470B2
Clone ID IST14470B2
Vector VICTR74
Project tigm

Sequence tag IST14470B2BBF1
Sequence
CAACAACCTAAAATGTTTACAGGTCACATGTCCAGCCTGCGGCCTGGACAGACTCCTGCCCCTTTCACCTCTCACAGAAC
ACACGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12331672..12331760 89
NO GENE  


Sequence tag IST14470B2HMR1
Sequence
GTTGGATGCCATGACCNGCCTCTGCAAACCCCAAGAAGGGCCCCATTAGAGCCAGAAGTCTAATGTAATACGTGTATAAA
GCAACCNCCCAAATCAATTNTAAAATGTTTAAGTTATATTTAGTGTGTGTGTGTGCGTGCACATTACATAGAGGAACACT
ATATGGCATACGTGGAGGTCAGAGGACCNCTTGCANAAGTGGTCCTCNCCTTCNNNCATGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI1127

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12331757..12331981 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]

 
Come back to gene ENSMUSG00000023827


For any suggestions or comments, please send an email to unitrap@crg.es