Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14192H10
Clone ID IST14192H10
Vector VICTR74
Project tigm

Sequence tag IST14192H10HMF2
Sequence
ACTGCTCTTCTGAAGATCCTGAGTTCAAATCCCANCAACNANATNGTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14192H10HMR1
Sequence
NNCACTGAAAACTNACCAAGTTCTAAGTCCNTCNGGGTGACACATGAATTCCCTGGCAGGCTGGGCTATTANGTAANATA
ACTTTGTTTCAGAAAACAAACTGGGGGGCTGAGGTGATGGCTCANAGGTTAAGAGCACTGGCTGCTTTTCTTGAGGACCC
AGGGTAGTANGCTCATTANCAGGGCCACACACTCTCATCACTCTCTAGCCCCAGAAGACCTGGGTTCAATTCCCAGCACC
CACATGGTAGCTCACAACTATCTGTAAGTCCAGTTCCAGTGAATCNGATGCCCTCTTCTGGCATCCATGGGTACTGAACA
CATAATTAAACAGGCATACATGAAGGCAAAAACACCTCTACATATAAAATAAAATAAAATAATTTTAAAAATGAATAGAA
TACNNACNGTTTCTATACNCTGTTGTANATATTTTCACTTANATCCTANTANTTAGAATTTANNCNNTCNTGTTNNANGG
GATGTTGGGAAATGTNCTCTTANTGTTTNNCCATAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14192H10BBF1
Sequence
ACTGCTCTTCTGAAGATCCTGAGTTCAAATCCCAGCAACCACATGGTGGG
Sequence Type genomic DNA
Unitrap ID UNI31140 UNI31141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 64481097..64481145 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28456467..28456515 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007570 (Fance) Fanconi anemia, complementation group E Gene [Source:MGI (curated);Acc:Fance-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17694397..17694445 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54981760..54981808 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022419 (Depdc6) NM_001037937 DEP domain containing 6 Gene [Source:MGI (curated);Acc:Depdc6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 55920039..55920087 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51549385..51549433 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72981564..72981612 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9139298..9139346 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 39899180..39899228 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23263215..23263263 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115550997..115551045 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 50116410..50116458 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24927610..24927658 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9039429..9039477 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35857037..35857085 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29615361..29615409 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 122097004..122097052 49
NO GENE  

 
Come back to gene ENSMUSG00000022419


For any suggestions or comments, please send an email to unitrap@crg.es