Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13619D6
Clone ID IST13619D6
Vector VICTR74
Project tigm

Sequence tag IST13619D6BBF1
Sequence
CCTCAAAGGAAAGCTTAAAAAATTTTAAGGCTATAGCTATAATCCTGAGTATCAGTCTCAAAACAGAAATTAACATACTT
CTGGCAAGAGTTATAAAATTATTAATTTGTGTCCCCATTGACTTCNAGTGANTACAAAACATGGTCTCTCCACTGCAAAG
TGGTGNNTGCANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83328866..83329036 161
NO GENE  


Sequence tag IST13619D6HMR1
Sequence
GAGGGACCTGCTTTAAAAAAATAGGTAGCAAAAAGCATTAAACAACAAGCAAATAAAGATATATGCTCAAGAGCAGGAAA
AGGTAGCTTACACTTTAACTGAGACAGTTGTCTC
Sequence Type genomic DNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83329033..83329145 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]


Sequence tag IST13619D6HMF1
Sequence
CCTCAAAGGAAAGCTTANAAAATTTTAAGGCTATAGCTATAATCCTGAGTATCANTCTCAAAACAGAAATTAACATACTT
CTGGCAANNGTTATAAAATTATTAATTTGTGTCCCCATTGACTTCNAGTGAGTACAAAACATGGTCTCTCCACTGCAAAG
TNNNGTGTGCNTACNTGTNAATGCNNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es