Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10927D7
Clone ID IST10927D7
Vector VICTR76
Project tigm

Sequence tag IST10927D7HMF1
Sequence
CAGACCAGGCTGGCCTCAAACTCAGAAATCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI32558 UNI32559 UNI32560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31707410..31707443 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79771210..79771243 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035575 (Utp6) NM_144826 UTP6, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI (curated);Acc:Utp6-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64919477..64919510 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122279539..122279572 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134488192..134488225 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028821 (Syf2) NM_026780 SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene [Source:MGI (curated);Acc:Syf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 15786990..15787023 34
NO GENE  

 
Come back to gene ENSMUSG00000028821


For any suggestions or comments, please send an email to unitrap@crg.es