Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14768G5
Clone ID IST14768G5
Vector VICTR76
Project tigm

Sequence tag IST14768G5HMF2
Sequence
NAGAGTATAGGGGTTGAAACAAAGTCCCATATAAGACAGGTTGGCCTTGAACTTGAACACTCTTCTGTGGCCCCCCAGCT
TCCCAAGTGCTGAGATGCAGATGTAAGTGTGATTTAGTGTTAAGTTTTANTAGGGTTCATGGAAGTCGTCCATTGCCCAA
AAGGCCAATTTGTGGTTGCCTGTCCTCCCAAGCGTANATTCTCCAAGCATAGATTCTGCTGTACCCACATGCTTTCTGAC
TACTATGTAATACTATATTGTTTCAGGAATGAAATGGTTTGCTTTGTTTCTCCTTTGGTTATTTAACTCACTATGATTGA
ATTATTATTTCATGCCTTTANGCTTCACGGAAACCCCGTGAGGAACGAGATGTATCTCAGTGTGAAAGTGTTGCTTCCAC
TGTTTCTGCCCAAGAGGANNNAGATATTGAANCCTCNAATGN
Sequence Type genomic DNA
Unitrap ID UNI35837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62190164..62190603 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST14768G5BBF1
Sequence
TTCTGAGACAGTATTTCTCTGTGTAACCTTGGCTGCCCTGAAACTCACTCTGTAGACCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es