Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST459203
Clone ID OST459203
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST459203
Sequence
AACCACATGCTATTAGAGCACAAGATGGAGCGTCCAGGCCCAGGCATCAAGCCAGGAGAGGTGGTGGCCACCAGCCCACT
GCCTTGCAAGAAAGAGCCCACACCTGCCACCAATGGCTGTACCGGCGATGCCAATGGGCACCCGCAGGCACCAACACCAA
AGCTGTCCACTGNTTAAATCAAGTGACCGGACCGNACCCTTNTACCCCCAATGCCTCCAACCATAGTACTTNAGCCCTTG
CCAAAGAC
Sequence Type mRNA
Unitrap ID UNI16521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73120921..73121168 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019139 (Isyna1) NM_023627 myo-inositol 1-phosphate synthase A1 Gene [Source:MGI Symbol;Acc:MGI:1919030]

 
Come back to gene ENSMUSG00000019139


For any suggestions or comments, please send an email to unitrap@crg.es