Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11615C8
Clone ID IST11615C8
Vector VICTR76
Project tigm

Sequence tag IST11615C8BBF1
Sequence
ATTCCNACTCCTGGGGGGAGGAGTAGACTGNGAAACAATGTCTGGGGTGCATGGCTGAGGCTATTGTGGATTGTTACTAA
AGCTATTATACTCTATGTCAGCAGCTTNNCAGGAAAAGCTAGAGCAAAGTTTANACCACCACTATCAAAACCANTAACTA
ATAACCCCCCCACCCACACACTCCCTNACACACTCCCTGATTCTTCTTCCANCTTNTNCAACACAAACTGNNCNNAAANN
NNTNTGAANCTGGGAGGTGGTGATGCCNNCCTTTGATCCNNGCACTAANAAGGCANANGCAGGCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11615C8HMR1
Sequence
GAATGAAAATGGAGGAGCAGCTGGGTGGTGGCGACCCATGCCTTTAATCCTAGCACTAGATAGGCAGAAGCAGGCAGGAT
CTCTGAGAGTTCAGAGGCCAGCCTGGCCTACAGAGTGAGTTCCAGGACGGCCANGGCTACNAGAGAAACCCTGTCTCAAA
AAGAGAGAANCGGGGTTGGGGGGNAAGGAN
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173343476..173343664 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es