Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11988B6
Clone ID IST11988B6
Vector VICTR76
Project tigm

Sequence tag IST11988B6BBF1
Sequence
GTTTGCAAACAGCCTGTGGCTAAGGGGCTGANACTGTCTGTTGAGGGTCTCACTACATAGCTCTGGCTGACCATTGCTGT
GTCNAACAGGCTANGCTTGAACTCACAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI33389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136437321..136437435 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]


Sequence tag IST11988B6HMF1
Sequence
GTTTGCAAACAGCCTGTGGCTAAGGGGCTGANACTGTCTGTTGAGGGTCTCACTACATAGCTCTGGCTGACCATTGCTGT
GTCNAACAGGCTAGGCTTGAACTCACAGAGATCTGCTTGCCTCTGCCTTCTTAGTGTTGGGATCANAGGTGTGTGCCAAC
TTGTCCAGCATTATTTATTGGTGTCTGTGTACCCGTGTATATGCATGATATGTTCACACATGTGAAGGCNAAACANTATG
AAGGAATGTGAAGGTCANANGACAACCTGTGGTGGCAAGTGCCCTCNACTGTANAGCCNTCTCTTGGGTCCCATGATCCC
NTGGGCTCNTCTGACCCAGGCCTTATCTCCNACACAGGGCACCTCCGTCTGGCTAGTGGAACACACCGATGTGANGGGCG
CGTNNAACTCTTCCTANGACAACGGTGGGGCACTGTTTGTGATGATGCCTGNGACCTACGGGCAGCCNTTGTCCTGTGCC
NTCANCTGNNANGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es