Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12987G7
Clone ID IST12987G7
Vector VICTR76
Project tigm

Sequence tag IST12987G7HMF2
Sequence
TTGTCACAAAACAAAAACTGTGTTAANCAACCGAAACTTCTTGAAATTCTCCTACAAAGCTCCTTTTATGGATAAAACTG
AGCATCTGTGTGATGACAGAACACAGGTATTCCCAGGAAGCAACACTGANTANCCCACAGCACTAACAATTCCCCCCTAC
CGCCCTANCAACCACATGAGTCCATCAAATCANAAGAAAAATATGCCAAGATCTCTGTGCATGCTTATCGCTGCANAATC
AGGAGACTCCCTGGGGCAAGCAGANAGTGCACGTCCTTCTAGGCCCTANAAGACTCTAGAATCTAGGACAAAGGGAAAGG
GTCTGAAAAATGACTCTNCCTTCCACCTAACTCCCATCATAAAAATGACATCTTGTGATTTNTCTANGTTTGGTTCTAAA
CANCNAATACAAAGTCNTAGGGTCTCN
Sequence Type genomic DNA
Unitrap ID UNI30579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63257838..63258262 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046856 (Gpr1) NM_146250 G protein-coupled receptor 1 Gene [Source:MGI (curated);Acc:Gpr1-001]


Sequence tag IST12987G7BBF1
Sequence
CTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAAACCAGGCTGGCCTC
Sequence Type genomic DNA
Unitrap ID UNI3643 UNI10238 UNI21486 UNI22809 UNI31483 UNI35839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35292488..35292540 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9537596..9537648 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15959952..15960004 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 46034911..46034963 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55252321..55252373 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 15028969..15029021 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4878922..4878974 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21701574..21701626 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12615964..12616016 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20825930..20825982 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 48395934..48395986 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038143 (Stox2) NM_175162 storkhead box 2 Gene [Source:MGI Symbol;Acc:MGI:1918319]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 24838806..24838858 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029678 (Hyal5) NM_028957 hyaluronoglucosaminidase 5 Gene [Source:MGI Symbol;Acc:MGI:1921718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36218415..36218467 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023072 (Ccdc123) NM_028120 coiled-coil domain containing 123 Gene [Source:MGI (curated);Acc:Ccdc123-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 44264637..44264689 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029084 (Cd38) NM_007646 CD38 antigen Gene [Source:MGI (curated);Acc:Cd38-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11392449..11392501 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9532253..9532305 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040209 (Zfp704) NM_133218 zinc finger protein 704 Gene [Source:MGI Symbol;Acc:MGI:2180715]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100534334..100534386 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4890486..4890538 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16397802..16397854 53
NO GENE  

 
Come back to gene ENSMUSG00000040209


For any suggestions or comments, please send an email to unitrap@crg.es