Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12588E3
Clone ID IST12588E3
Vector VICTR76
Project tigm

Sequence tag IST12588E3BBF1
Sequence
CTAGGTTGTAATAATTAAATNAAAGTAACAGGTCGCTGGCCTTAGGAGAACCTCAGAGTTTGCATATCTTTTTCTCTTTC
CTCCTCCCTGCTATTCCAGTCTCTGTCTCATCTCATGATTGGGAGTTCTGTGGAGGGTCTCAGGGAAGAAGTGAGACTAA
TGTGAAAAAACCCTGGGGCAGGGAGAGTTGGAAAAGACATTATGGAGAGACAGAACAGACTANAANACTGTGGTCAGCCC
AGAAGACCATTAAAAGTGTGAAGCTGAAATGGAAGANGATTGCTTAAACCTAAGAGTTCAAGATCAGCCTGGGCTACATA
GTAAAAACAAATTCNTGANCTTTGAAGTAGGTTAAGAACCACTAGATGGCTCTTTANTTATTTTAAAATTNAAAATATAT
TANAATTTTTAAATGACNTGTGTTGTGGATNGCTCTGGAGCTGATTANNTTTT
Sequence Type genomic DNA
Unitrap ID UNI19577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93183586..93184037 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es