Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14534A4
Clone ID IST14534A4
Vector VICTR74
Project tigm

Sequence tag IST14534A4HMF1
Sequence
NCTGTGANCNNCACTGATTGCAGCATGCCATCGGGCAATCCCACAATGGCTCCCACCTGTCCCACCTAAAGCCTCTTTGG
AGCAAAAATCTGAGATAGGGAGGAGATTGTTAAAGGTTCCAATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95031410..95031532 117
 
EST/CDNA Est Name
  AA111290.1


Sequence tag IST14534A4HMR1
Sequence
CAGGAACNACTTATGACAGCAGATTTGTCTTTGCAGCTCCTCCTANAAAAAGGGGAGGATTGTGGCTAATAGGAAAATCC
TAGAGCAACATGAGAAATACCAGGAAGCCTCCATTTTCATCCACCACCATCCCTCCTTANACTGCATGGTC
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95031263..95031412 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]


Sequence tag IST14534A4BBF1
Sequence
CCTGTGAGCTACACTGATTGCAGCATGCCATCGGGCAATCCCACAATGGCTCCCACCTGTCCCACCTAAAGCCTCTTTGG
AGCAAAAATCTGAGATAGGGAGGAGATTGTTAAAGGTTCCAATCACTCTCAATAGCATCTCATGTTTAAAAAAAAAAAAA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95031409..95031568 160
 
EST/CDNA Est Name
  AI037664.1 - AA111290.1

 
Come back to gene AI037664.1 - AA111290.1


For any suggestions or comments, please send an email to unitrap@crg.es