Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14830C9
Clone ID IST14830C9
Vector VICTR76
Project tigm

Sequence tag IST14830C9HMF1
Sequence
GTCTCATAGAAGCCCCCCCACCCCAACCCATTTTATGATTCACCCCCAGCTCCTATGGTTTTCAAAGTGGGATGCAGAGT
TCGACTCAAGCCTGTGCAATGACCGGGACACAGTGATCGCTCTCCTTCCCTTCAGGCTCTCCTTCCCCTGGTCTTCAGCT
TCAGGGTCCCCCAAACAGCAGCCCTTCAATCAGGCCATCTTGGCGGGAGAAATCGTTATTCAGTGCTGACAGAGACTGAG
GAGCCAAGGCTGGGCTGAGCTCCAACACCCTTGAGTCCCAAAGGCTCCTTTTCACCCGACAGCCCTGGTATAGCAACCCT
GGTATGGAGAANGCAATTGCAGACAGGGCGCTGCCCCAGGGTGCACTGCGTGTGCATTGAGAACTCGGTGGAAAGCTTGA
CATACAGGCAGCCCTGTATGGAGAGCATCAGCAAGGGGATTCTAGGACAGCTGCGGACGGGCTGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58157770..58158237 466
 
EST/CDNA Est Name
  BF124580.1 - BI414162.1 - BE309687.1 - BF152445.1 - AI322695.1 - BI113536.1 - BF135282.1 - AI390912.1 - BQ947000.1 - AA047909.1 - BF015570.1 - AA049290.1 - AA039213.1 - CK137712.1 - BE226336.1


Sequence tag IST14830C9HMR1
Sequence
AGACAATGCCNAACACCTCCACCGAGCTCTGTCNCCAGCTTGGCATAGCCTGCAGCAGTCTACCATGGCTTTGTGCTGAC
TTGCCTCTCCTGGGAGCCCCTTGTAAGAGGTGTGGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI32007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58157651..58157773 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]


Sequence tag IST14830C9BBF1
Sequence
GTCTCATANAAGCCCCCCCACCCCAACCCATTTTATGATTCACCCCCNNCTCCTATGGTTTTCAAAGTGGGATGCANAGT
TCGACTCANGCCTGTGCAATGACCGGGACACAGTGATCGCTCTCCTTCCCTTCANGCTCTCCTTCCCCTGGTCTTCANCT
TCANGGTCCCCCANACNNCANCCCTTCNATCANGCCNTCTTGGCGGGAGAAATCNTTATTCAGTGCTGACNGAGACTGAG
GAGCCAANGCNGGGCTGANCTCNANCNCCCNTNANTCCCAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es