Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10636H4
Clone ID IST10636H4
Vector VICTR76
Project tigm

Sequence tag IST10636H4BBF1
Sequence
AGGTCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI675 UNI703 UNI3451 UNI10854 UNI33716 UNI35842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20916573..20916638 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8445296..8445361 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4890718..4890783 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12775314..12775379 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022191 (Rnasen) NP_001123621 ribonuclease III, nuclear Gene [Source:MGI (curated);Acc:Rnasen-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5497716..5497781 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72127675..72127740 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048118 (Arid4a) NM_001081195 AT rich interactive domain 4A (RBP1-like) Gene [Source:MGI (curated);Acc:Arid4a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88219390..88219455 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069769 (Msi2) NP_473384 Musashi homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Msi2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71025208..71025273 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54940109..54940174 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42165188..42165253 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038302 (Lace1) NM_145743 lactation elevated 1 Gene [Source:MGI (curated);Acc:Lace1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 32285349..32285414 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 119357319..119357384 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 38047147..38047212 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9892121..9892186 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 107108229..107108294 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19901921..19901986 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24722230..24722295 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036893 (Ehmt1) NP_001012536 euchromatic histone methyltransferase 1 Gene [Source:MGI (curated);Acc:Ehmt1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 58479127..58479192 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026034 (Clk1) NM_009905 CDC-like kinase 1 Gene [Source:MGI (curated);Acc:Clk1-001]

 
Come back to gene ENSMUSG00000026034


For any suggestions or comments, please send an email to unitrap@crg.es