Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14943E6
Clone ID IST14943E6
Vector VICTR76
Project tigm

Sequence tag IST14943E6HMF1
Sequence
CAGGCTGGCCTGGAACTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGTGCCACCACATCCGG
CGTTTTGTTTGTCTTTTTAAGGGAGAAAGCTTTCTAAAGAAGGTGCTATGANTGGAACTATATCCCTCACCCCCCAAGAT
ATATCGAAGTCCTAACTCCTANTACCTCAGAATGTCACCCTCTTTGGAAGTAGGAAGATTACACATGTGGACAGGGACNC
NCTGGGGAAGGCCNNGTCCCTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93922936..93923196 249
 
EST/CDNA Est Name
  AA271010.1


Sequence tag IST14943E6BBF1
Sequence
CAGGCTGGCCTGGAACTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGTGCCACCACATCCGG
CGTTTTGTTTGTCTTTTTAAGGGAGAAAGCTTTCTAAAGAAGGTGCTATGAGTGGAACTATATCCCTCACCCCCCAAGAT
ATATCGAAGTCCTAACTCCTAGTACCTCANAATGTCACCCTCTTTGGAAGTAGGAAGATTACACATGTGGACAGGGACAC
ACTGGGGAAGGCCAGGTCCCTAAACCGAATTANTGTCTTACAAAGTCCCTGANGACTGAGGCANANTTTGGAATGACTCN
NCNNGAANCCNNNANTGTTNNANNNGTTNGGGGAGAANGTGGGGGCNNGNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14943E6HMR1
Sequence
CCTGGTCTACAGAGTGAGTTCCAGGAAACCCAGGAGAAACCCTGTCTCAAAAAACCAAAACAAACAAACAAAACAAAAAA
CAAAAGCAAAAGCAAACAGCTATTANTATTTAATAATCATTTAACACTAAAAAAATGCTTGCATTGATCAGGGGAATATA
TACTTTTTCTTTTAGTTTTCTTTGTTCTTATACTTTGTCCTTATACTTTGTCCTTATAGGGCANACTTTTGAAAAATGAA
AAATAACCTANAAAACCTACNCCACTAANAAAAAAATGCTATGAAAATTGAGTTTCGCCGGGCATGGAGGCACACGCCTT
TAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCNAGGCCN
Sequence Type genomic DNA
Unitrap ID UNI30483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93922569..93922939 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es