Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15067E1
Clone ID IST15067E1
Vector VICTR80
Project tigm

Sequence tag IST15067E1BBF1
Sequence
GAGGTAACTTCAAGCTTTTCATTCCTTGTGGACAACTTACTACATTAATCAGCCCTGGTCATTCTTGGAAGCACTGATTC
CTATTCGTCTACAGACCTGGAGAAAGGTACCAGGCATTCAACAGTGTTTGCTTTTCCTGTGACACAGAAGTCAACCTGAA
CCTGAGAAGCAGAAGCAGTTGGTGCACACAGACGAACATGCTTAACGTAGCGCAGAAGCGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 53258952..53259171 220
 
EST/CDNA Est Name
  BE448892.1


Sequence tag IST15067E1HMF2
Sequence
GAGGTAACTTCAAGCTTTTCATTCCTTGTGGACAACTTACTACATTAATCAGCCCTGGTCATTCTTGGAAGCACTGATTC
CTATTCGTCTACAGACCTGGAGAAAGGTACCAGGCATTCAACAGTGTTTGCTTTTCCTGTGACACAGAAGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 53259017..53259171 155
NO GENE  


Sequence tag IST15067E1HMR1
Sequence
AATACTAAAAGAGAGCACATGGATGCATACACCANACTAACTCGGGATAGGGTATGAGTATACGGGTTATGAGAATGCTG
AGGCTCCAGGAGGTTGAGTTTCCGTGAAATTCTTTGCCTCATGAGTGCTTCCAGGCCTCTCGGCCTGCCAAGCAGGCTTC
ACTGGAGTGTGCATAGCAGATAATATTTTACTTTATGAAATAAAAGGGACTTCAGTTGCGCTGCCCCCCTTTCTCTGCCT
CTGCGCTGTTCTCCAGTCCCCTTCTCCTTCCCCCAATAAACTTCCTTTTATACTAGATCTGTCATACGGCTGACTCCTCA
AGGGGAAATGCCTCANCATGGGCACACTGANGTGCTTCCTCCNACCNTATTATACCCCATGTTTTATAAAACNCNNNTTC
Sequence Type genomic DNA
Unitrap ID UNI34050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 64207457..64207848 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060843 (Ctnna3) NM_177612 catenin (cadherin associated protein), alpha 3 Gene [Source:MGI (curated);Acc:Ctnna3-001]

 
Come back to gene ENSMUSG00000060843


For any suggestions or comments, please send an email to unitrap@crg.es