Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15090E12
Clone ID IST15090E12
Vector VICTR80
Project tigm

Sequence tag IST15090E12BBF1
Sequence
ACCAGGATAAACCTGAACCTGCAGCGGGAAACACACTTGGCTTTTGTCTGCACCGTAGAAGGAACGCTGTTTGTCCCTCC
CTGTGGTAGAGCACAGTCCTGTGACAGCAAACTCCAGGTCTCCCAAGAAACAAGCACGGCGAACTTGTATTTTTCCAAGT
TGACTTTATGCTTGAACCCCCGCAGCCTAGACCAATAGAGCATCCTCCCGGGTGGGCGTGGCCATGCTGTGTGGGCCGGG
TTTTTGTTTTTTGGTTTTTTTTTCCCCNNNCNNTGNCNNCNTANCTTCTTGCTGCATTTNCCNAACAAAGTCTCAACANT
GAANCNNCGTGTANACNCCNGTGTCNGCNCTTTTNANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15090E12HMR1
Sequence
CTGGTCTGCTGGTTTGATTTTCCNATTCGGATTCAAAACCAAGAAAAGCAATGCCAGCCACCTGGGAGGGAGGAATCTCG
CGGCACTCACCCTACCCACCGGTAATCCAGTGTTTTCAGGGAGACCCACCACTGGCATTGGCTGAGAAGTGACTTTCCTA
GGGAGTGGTGGTGGTTAGCCTGTTGCTTGGGGGAACACCAGCACGGCTCCAGCTTTCCACTTTACAGCCTCCTTTCCTAT
TAACATGGGTTTCATGTGGAGCTTTCTGCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71157905..71158175 269
 
EST/CDNA Est Name
  AW492511.1


Sequence tag IST15090E12HMF1
Sequence
ACCAGGATAAACCTGAACCTGCAGCGGGAAACACACTTGGCTTTTGTCTGCACCGTANAAGGAACGCTGTTTGTCCCTCC
CTGTGGTAGAGCACAGTCCTGTGACAGCAAACTCCAGGTCTCCCAAGAAACAAGCACGGCGAACTTGTATTTTTCCAAGT
TA
Sequence Type genomic DNA
Unitrap ID UNI13115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71158171..71158331 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es