Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10825G6
Clone ID IST10825G6
Vector VICTR76
Project tigm

Sequence tag IST10825G6BBF1
Sequence
AAGGCCATACCCCTAGACCTTCCCAAACCGTCCTACTAACTGGGGCGTTCAAACAAATGAGCCTGGAGGGGGGGGGGNAA
TTT

Sequence Type genomic DNA
Unitrap ID UNI35846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52892623..52892704 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022159 (Rab2b) NM_172601 RAB2B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1923588]

 
Come back to gene ENSMUSG00000022159


For any suggestions or comments, please send an email to unitrap@crg.es