Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10894D2
Clone ID IST10894D2
Vector VICTR76
Project tigm

Sequence tag IST10894D2HMF1
Sequence
NGCCTTANCTACACAGTGAGACCTTGNCTNAAANANANNNNNNAAACAAAAAAGAAAAAAAATCAACTTTGGAATCTNAC
ANACACGGACTCAACTTCCAGCTTNTTGCTACTTNTAAGCTGTGGNAACTGAAAATTCTAATTTCTTTTAAGGCACTTAT
AAAAGTGAAATANGGATTANATTCCGTCTACAAACTTANTAAGATGGTATATGCAAGCTCNTTATACAATAGTTAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10894D2HMR1
Sequence
GGCCNGTCTTGAACTCAAGGTCCTCCTGGTTCCATATTCTCAGAGTGCTCTGTGTATAATCTTATGGTGATC
Sequence Type genomic DNA
Unitrap ID UNI435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32855585..32855656 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es